منابع و ماخذ پایان نامه ارزیابی کیفی

دانلود پایان نامه

بترکند و هستهها بیرون بریزند.
(٣) انجام مراحل ١ و ٢، تا سه مرتبه تکرار شد تا لایه سلولی با رنگ صورتی شفاف حاصل گردد که به معنای حذف کامل گلبولهای قرمز می باشد.
(۴) سپس ۵٠٠ میکرولیتر(TES)Tris-EDTA-salt اضافه و کاملا مخلوط گردید. در این مرحله گلبول های سفید لیز شده و رسوب به دست آمده کاملا به حالت محلول در میآید.
(۵) به محلول فوق ۵٠ میکرولیتر محلول سدیم دو دسیل سولفات85(١٠ درصد) افزوده شد و بعد از اضافه کردن ١٠ میکرولیتر پروتئیناز K (٠٢/٠درصد) و بعد از اینورت کردن ملایم این مخلوط، درب میکروتیوپ ها با پارافیلم بسته شد و سپس بین ۴تا ٢۴ساعت در دمای ٣٧ درجه سانتیگراد در داخل بنماری قرار داده شد.
(۶) پس از خروج میکروتیوپها از بن ماری، به میزان یک سوم حجم موجود (١۵٠میکرولیتر) محلول کلرید سدیم (NaCl) اشباع به آن افزوده شد تا رنگ آن کدر شود. در صورت عدم تغییر باید میزان NaCl را بیشتر کرد. عمل NaCl، کمک به رسوب پروتئینهاست.
نکته: معمولا اولین حجم ٢۵٠ میکرولیتر خواهد بود که در اکثر موارد بعد از کمی تامل کدر میشود. در صورت نیاز هر بار به میزان ١٠ میکرولیتر اضافه میگردد. چرا که، مقادیر اضافی NaCl در محیط، به عنوان مهار کننده PCR عمل می کند . (٧) پس از سانتریفیوژ در ٨٠٠٠ دور در دقیقه به مدت ٢٠ دقیقه، محلول رویی به یک لوله ی تمیز و استریل انتقال داده شد و به میزان حداقل ٧/٠حجم محلول (حدودا ۵٠٠ میکرولیتر) به آن ایزوپروپانل افزوده شد تا کلاف DNA ظاهر شود.
نکته: در مواردی که کلاف دیده نمیشود میتوان محلول الکل و DNA را برای یک ساعت در فریزر قرار داد تا کریستاله شدن تسریع گردد.
(٨) مجددا میکروتیوپها در ٨٠٠٠ دور در دقیقه و به مدت ٣٠ ثانیه تحت سانتریفیوژ قرار گرفتند و سپس مایع رویی حذف گردید.
(٩) با هدف شستشو، ١٠٠ میکرولیتر اتانول ٧٠درصد به رسوب فوق افزوده شد و سانتریفیوژ گردید. این مرحله، جهت حذف نمکهای باقی مانده، که مانع PCR هستند، ٣ مرتبه تکرار میشود .
(١٠) سپس، درب میکروتیوب باز گذاشته شد تا الکل باقیمانده تبخیر شود.
میتوان از ترموبلاک با دمای ٣٧درجه سانتیگراد هم استفاده کرد. البته باید توجه داشت که مدت زمان استفاده نباید زیاد باشد در غیر این صورت DNA بیش از حد خشک میشود.
(١١) با توجه به حجم DNA بین ١٠٠ تا ٢٠٠ میکرولیتر آب مقطر استریل بدان افزوده شد تا DNA حل گردد و سپس در دمای ۴ درجه سانتی گراد نگهداری شدند.
٢-٢-٣)روش استخراج DNA با استفاده از کلروفرم:
مواد لازم:
• آب مقطر
• NaCl اشباع (۶مولار)
• N-Lysis
• کلروفرم
• اتانول ١٠٠%
• اتانول ٧٠%
• تجهیزات لازم:
• میکروتیوپ با حجم ۵/١ میکرولیتر
• سانتریفیوژ با حداکثردور ١۴٠٠٠ (اپندروف)
• هات پلیت (زیماژن-ایران)
• میکروفیوژ ورتکس (mxcell)
• هود لامینار کلاس ٢ یا هود PCR یا PCR Work Station(زیماژن)
• سمپلرهای متغیر از١٠ تا ١٠٠٠میکرولیتر(socorex)
• سر سمپلر های کریستالی، زرد و آبی رنگ
• دستکش های لاتکس
• رک سر سمپلر
• روپوش
• پارافیلم

روش تهیه محلولهای مورد نیازجهت استخراج DNA:
روش تهیه محلول کلریدسدیم ۶ مولارNaCl ۶ M ) )

جهت تهیه100 میلی لیترمحلول کلریدسدیم 6 مولار مقدار31 /564 گرم NaCl درآب مقطرحل گردید وحجم نهایی به100 میلی لیتر رسانده شد، محلول حاصل در دمای اتاق نگهداری میشود.

محلولN-Lysis:
محصول شرکت
وزن
ماده
Merck
58gr
Tris
Merck
1/57gr
EDTA
Sigma
5 gr
SDS

مواد ذکر شده در جدول فوق را با حجمهای مورد نظر مخلوط کرده و سپس با استفاده از آب مقطر دیونیزه حجم نهایی را به 500 میلی لیتر میرسانیم.
استخراج DNA از خون به روش کلروفرم:
این روش در دو مرحله انجام میشود:
مرحله اول

مطلب مرتبط با این موضوع :  دانلود پایان نامه دربارهمیانگین دما، هزینه های اضافی، استان آذربایجان شرقی، آذربایجان شرقی

1) 500 میکرولیترخون را درویال 1.5 میلیلیتری ریخته به آن 800 میکرولیتر آب مقطر سرد اضافه نموده و آن را پیپتینگ میکنیم. سپس آن را با دور rpm 9000 به مدت 20 دقیقه درسانتریفوژ قرار میدهیم . این عمل راتاسه بارتکرار مینماییم .
2) مایع رویی را دور ریخته و رسوب را نگه میداریم.
3) اضافه نمودن 300 میکرولیتر- N-lysis به رسوب برجای مانده وپیپتینگ آن جهت لیزشدن هسته سلولها .سپس به مدت 2ساعت در دمای آزمایشگاه قرارداده شد.
4) اضافه نمودن250 میکرولیتر- NaCl اشباع وورتکس نمودن آن جهت حذف پروتیینها.
5) اضافه نمودن 600میکرولیترکلروفرم وورتکس نمودن آنها وسپس نمونهها با دور rpm 4500 به مدت 4 دقیقه سانتریفوژ شد) به منظور جداشدن DNA ازسایرقسمتها به واسطه تشکیل دوفاز مختلف(.
6) جدا کردن مایع رویی حاوی DNA و منتقل کردن آن به یک میکروتیوپ استریل دیگر به نحوی که با کلروفرم زیر آن مخلوط نشود.
7) اضافه کردن1000میکرولیتر اتانول مطلق سرد برای کریستاله کردن DNA ، سپس درب ویال را با پارافیلم پوشانده و به مدت 24 ساعت در یخچال نگهداری شد.
مرحله دوم

1. جهت رسوبDNA روز بعد ابتدا نمونهها درrpm 10000به مدت2 دقیقه سانتریفوژ شد. اگرDNA مشاهده نشد به مدت 20 دقیقه با دور 14000 rpm سانتریفوژ میشود.
2. سپس مایع رویی را دور ریخته و شستشوی نهایی با الکل70درصد به مقدار 250 میکرولیتر انجام میدهیم. )این عمل را تا سه بارتکرارمیکنیم و هر بار درrpm 10000به مدت دو دقیقه سانتریفوژ میکنیم (. درآخرین شستشو الکل را دور ریخته و درب ویال را باز گذاشته تا الکل کاملاخشک شود.
اضافه کردن70 تا100میکرولیتر آب مقطر جهت حل شدن رسوب DNA.
٣-٣) سنجش کیفیت و کمیتDNA
١-٣-٣) سنجش کمیت و کیفیت DNA با استفاده از نا
نودراپ
کیفیت و کمیت تمام نمونه های DNA استخراج شده توسط دستگاه نانودراپ، با نسبت OD 260/280 (نشانگر خلوص) انجام شد. برای این کار بعد از صفر کردن دستگاه با آب مقطر، ۵ میکرولیتر از DNA متعلق به هر یک از نمونه ها به جایگاه مخصوص در دستگاه نانودراپ منتقل شد.
اگر نسبت مقدار جذب محلول DNA در طول موج ٢۶٠ نانومتر به مقدار جذب در طول موج ٢٨٠ نانومتر در محدوده ٢- ٨/١ باشد، نشان دهنده این است که جذب عمدتا به علت اسید نوکلئیک است و کیفیت و خلوص DNA مطلوب است. اعداد کمتر از ٨/١آلودگی پروتئین یا فنلی را نشان میدهد و اعداد بالاتر از ٢ نشان دهنده آلودگی RNA هستند.
٢-٣-٣) ارزیابی کیفیت DNA استخراج شده به کمک ژل آگارز (الکتروفورز افقی)
مواد و تجهیزات مورد استفاده جهت ارزیابی کیفیت DNA استخراج شده به کمک ژل آگارز
مواد لازم:
• بافر TBE با غلظت 1x
• پودر آگارز (شرکت زیست فناوری کوثر)
• بافر لودینگ
• DNA استخراج شده
• پودر ساکارز (محصول شرکت Merk)
• بروموفنول بلو )محصول شرکت Sigma)
• سایبرگرین (محصول شرکت Bioron)
تجهیزات لازم:
• بشر
• هیتر برقی (Persia shimi)
• سینی ژل و شانه (محصول شرکت پایا پژوهش پارس)
• تانک الکتروفورز (محصول شرکت پدیده نوژن پارس)
• منبع تغذیه (محصول شرکت فن آوران سهندآذر)
• دستگاه ترانس لومیناتور (محصول شرکت کیاژن)
• سمپلر(محصول شرکتsocorex )
• سر سمپلر
• مگنت مغناطیسی (Persia shimi)
• نانو دراپ (ترمو ساینتفیک آمریکا)
طرز تهیه بافرها
الف) بافر x ١٠ TBE
مقدار ۵/٧ گرم EDTA در ۵٠ میلی لیتر آب مقطر حل کرده و به مخلوط حاصل ٩٩/١٠٨گرم Tris base و ۶۵/۵۵گرم Boric acid اضافه کرده و توسط آب مقطر به حجم ١٠٠٠میلی لیتر رسانده شد.
جهت تهیه بافر TBE با غلظت 1x، ١٠٠ میلی لیتر بافر x ١٠ TBE را با ٩٠٠ میلی لیتر آب به حجم ١لیتر رسانده شد.
ب) بافر لودینگ
مقدار ۵٠٠ میکرولیتر لودینگ بافر و ۵٠٠ میکرولیتر (Dmso)Dimethyl sulphoxide به ۵ میکرولیتر سایبرگرین اضافه شده و به میزان بسیار اندک پودر بروموفنل بلو در این مخلوط حل گشت. لازم به ذکر است برای تهیهی لودینگ بافر ۵٠٠ میکرولیتری اولیه ۴٠ گرم ساکارز ۴٠٪ همراه با ٢ ، ۵ گرم بروموفنول بلوی ٢۵٪ با آب مقطر به حجم ١٠٠میکرولیتر رسانده شد و محلول حاصل برای ساخت بافرلودینگ در دمای ۴ درجه نگه داری شد.
روش کار
(١) پس از رفع آلودگی ها با استفاده از الکل، دو سمت سینی مخصوص ژل را با استفاده از چسب نواری به طور محکم بسته و سپس شانه ژل درون سینی قرار داده شد.
(٢) برای تهیه ۵٠ میلی لیتر ژل آگارز ٢درصد، ١ گرم پودر آگارز به همراه ۵٠ میلی لیتر بافر TBE1x در یک بشر ریخته شد و بشر بر روی هیتر قرار گرفت تا آگارز کاملا حل شود. جهت همگن کردن این محلول از مگنت مغناطیسی استفاده شد.
(٣) پس از این که محلول شفافی مشاهده گردید، بشر از روی حرارت برداشته شد و در دمای آزمایشگاه قرار داده شد تا کمی خنک شود. سپس درون سینی ژل ریخته شد تا ببندد.
(۴) پس از بسته شدن ژل، شانه به آهستگی برداشته شد و چسب های اطراف سینی باز گردید و سپسس سینی محتوی ژل درون تانک الکتروفورز قرار داده شد و مقداری بافر TBE-1 x درون تانک ریخته شد.
(۵) ۴میکرولیتر از DNA استخراج شده همراه با ٢ میکرولیتر بافر لودینگ مخلوط و با دقت درون چاهک های ژل تزریق شد.
(۶) منبع تغذیه بر روی ولتاژ ٩٠ تنظیم شد و پس از مدت ٢٠ دقیقه جریان قطع گردید و بر روی دستگاه ترانس لومیناتور و با کمک نور UV مشاهده شد.
۴-٣) ژنوتایپ کردن نمونه ها)ژنوتایپینگ)
واکنش زنجیرهای پلیمر از (PCR)
PCR روش بسط آنزیمی یک قطعه از DNA هدف است که بین دو بخش الیگونوکلئوتیدی قرار دارد. این واکنش به منظور ایجاد مقادیر نامحدود باز یک توالی مورد نظر میباشد. درواقع PCRمیتواند از یک مولکول منفرد از DNA در مدت چند ساعت چندین بیلیون ملکول را تولید کند. این روش هم درتشخیص مولکولی و هم درآنالیز مولکولی بیماریهای ژنتیکی انقلابی به وجود آورده است.
روش (ARMS/PCR) Amplification Refractory Mutations Systemیک روش نسبتاً ساده سریع جهت تعیین جهشهای نقطهای، حذف و اضافه شدن چند نوکلتوئیدی و چند شکلیهای پلی مورفیسم (Polymorphism) است. این تکنیک سنجش دو لولهای با پرایمرهای طبیعی و جهش یافته در واکنشهای جداگانه می باشد که با پرایمرهای کنترلی همراه میباشد تا از انجام واکنش PCR اطمینان حاصل شود. (۴۵)
در (Tetra ARMS/PCR) Tetra Primer Amplificati Refractory Mutations Systemبرای تشخیص یک جهش ویژه، یک جفت آغازگرکنترل در طرفین محل موتاسیون برای اطمینان از عملکرد صحیح PCR طراحی میشود. برای تکثیر منطقه حاوی جهش نیز از یک جفت آغازگر که به ترتیب برای آلل جهش یافته و آلل طبیعی طراحی شده، استفاده میگردد. (تصویر٣-٢) پس از انتخاب جفت آغازگرها به منظور اطمینان از ویژگی آنها دراتصال به ناحیه مکملی خود در ژن مربوطه، توالی آغازگرها با تمامی توالی ژنوم انسان در پایگاه اطلاعاتی Gene Bank مقایسه گردید. به منظور افزایش ویژگی جفت آغازگرهای اصلی، علاوه بر عدم تطابق انتهای’ ۳،2 یا 3 آلل در انتهای 3َ از پرایمرهای داخلی را تغییر میدهیم تا از اتصال احتمالی آن آغازگر به آلل مخالف ممانعت به عمل آید. (۴۶)
در این آزمون برای شناسایی پلی مورفیسم 242557 rsاز ژن MAPT ,تکنیک Tetra ARMS/PCR استفاده شد. در این تکنیک ما از ۴ پرایمر استفاده کردیم که خصوصیات کلی آنها در جدول زیر گزارش شده است.
جدول ١-٣مشخصات کلی پرایمرها
Primers name
Volume of DW adding to one µL of each primers
Volume of primer
Sequence
TM
Final Concentrati
on
EPCR-A3-FC
350 µL
0.3
TAGAGCAACAAGAGGCCCACAG
68
100 nmol
EPCR-A3-RM
190 µL
0.6
CACACCAGCAATGATGATACC
62
100 nmol
EPCR-A3-TFN
230 µL
0.6
CCTGGGCGTCCTGGTGTGCA
68
100 nmol
EPCR-A3-RC
230 µL
0.3
TGCCAGCCTCCATCAATCCAG
64
100 nmol

مطلب مرتبط با این موضوع :  پایان نامه با موضوعرفتار انسان

آغازگر ها86
طراحی پرایمر به روش Tetra ARMS/PCRبا استفاده از نرم افزارهای آنلاین primer3و آفلاین Gene runner و چک در سایتهای UCSC و NCBI و انجام تست بلاست در سایت NCBI/BLAST صورت گرفت. در تحقیق حاضر سفارش ساخت پرایمرها به شرکت زیست فناوری کوثر(KBC) (www.kawsar.ir) فرستاده شد. این شرکت سنتز پرایمرها را با همکاری کمپانی Biolegio(/http://www.biolegio.com) انجام میدهد.
طبق دستورالعمل شرکت که به همراه پرایمرها ارسال شده است، باید به کرایورهای حاوی پرایمرهای لیوفلیزه آب مقطر دیونیزه اضافه کرد و آن را خوب پپیتاژ کرده تا محلول پرایمر مایع یکدست با غلظت ١٠٠ پیکومول فراهم گردد. از محلول اصلی، محلول کار (Working) با غلظت μL١٠٠ تهیه‌کرده و به منظور PCR مورد استفاده قرار گرفت.م حلول کار برای تمامی پرایمرها به این صورت تهیه شد که میزان μL٣/٠از پرایمر FC،μL٣/٠از پرایمر RC، μL۶/٠از پرایمرRM وبه میزان Μl0.6 از پرایمرTFN، با μL٨٢آب مقطر به حجم μL١٠٠ رسانده ‌شد. پرایمر تهیه شده در فریزر در دمای ٢٠- درجه سانتی‌گراد برای مصارف بعدی نگهداری ‌شد.

مواد و تجهیزات مورد استفاده در واکنشPCR
تجهیزات لازم:
• ظرف حاوی یخ
• دستگاه ترموسایکلر (محصول شرکت اپندروف)
• دستگاه میکروسانتریفیوژ (محصول شرکت Labnet)
• میکروتیوبهای ٢/٠میلی لیتری
• سر سمپلر کریستالی و زرد
• سمپلرهای با حجمهای ۵/٠- ٠، ١٠- ۵/٠ و ١٠٠- ١٠ میکرولیتر (محصول شرکت BrandTech)
مواد لازم:
• DNAبا غلظت ۵٠ نانوگرم (ng)
• پرایمرهای ١٠ میکرومولاری (µM)،
• آب مقطر،
• Taq DNA Polymerase 2x Master Mix Red
جهت انجام واکنش PCR ، مخلوط واکنش با حجم نهایی ٢٠ µL درون لولههای اپندورف (٢/٠ml) مطابق غلظتهای زیر فراهم گردید:

مطلب مرتبط با این موضوع :  مقاله درمورد دانلودهورمون رشد، نمونه برداری، رنگین کمان، کشاورزی و منابع طبیعی

جدول ٢ -٣

One Reaction
Master Mix
10µL
4-PRIMER
1.8 µL
DNA
2.5 µL
Water
5.7 µL
Total
20 µL

نمونهها در دور بالا به مدت ٣٠ ثانیه سانتریفوژ گردید و سپس در دستگاه ترمو سایکلر قرار داده شد . برنامه زیر برای دستگاه تنظیم گردید.

جدول ٣-٣ برنامه مورد استفاده جهت انجام PCRژنMAPT

PCR Programs

Initial denaturation

95°C for 5 min
cycles:
START LOOP
35X

Denaturation
94°C for 40 Sec

Annealing
68°C for 40 Sec

Extension
72°C for 40 Sec
Final Extension

72°C for 5 min
Soak

10°C

روش کار
ابتدا Taq DNA Polymerase 2x Master Mix Redو آغازگرها (Primer) از فریزر خارج و مدتی در دمای اتاق قرار داده تا آب شوند. البته کلیه مواد فوق بر روی ظروف حاوی یخ انجام گرفت. مقادیر مورد نیاز از هر ماده، به ترتیب از بیشترین حجم به کمترین حجم در میکروتیوبهای ٢/٠میکرولیتری ریخته شدند. در نهایت بعد از ریختن آب

پاسخی بگذارید